Stem-loop sequence cli-mir-9618

AccessionMI0030095 (change log)
DescriptionColumba livia miR-9618 stem-loop
Stem-loop
   uca           c ug        c   c   ----    cgg g 
5'    agcuguggggu c  gcagaggg cca ucu    uggc   g g
      ||||||||||| |  |||||||| ||| |||    ||||   |  
3'    ucgacacccca g  cgucuccc ggu aga    accg   c g
   acg           c gu        a   -   aacu    aaa a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375305.1: 1390768-1390858 [-]
intergenic
Clustered miRNAs
< 10kb from cli-mir-9618
cli-mir-1788KB375305.1: 1391510-1391586 [-]
cli-mir-9618KB375305.1: 1390768-1390858 [-]
Database links

Mature sequence cli-miR-9618-5p

Accession MIMAT0038725
Sequence

17 - 

uggcagagggcccacucuuggc

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-9618-3p

Accession MIMAT0038726
Sequence

53 - 

caucaaagauggacccucugcugg

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).