Stem-loop sequence cli-mir-9619

AccessionMI0030096 (change log)
DescriptionColumba livia miR-9619 stem-loop
Stem-loop
   ugugagc   a   aa        a          gu  auu 
5'        cug ucc  uauuccuu aguaggcaaa  ug   c
          ||| |||  |||||||| ||||||||||  ||   u
3'        gau agg  auggggaa ucguccguuu  ac   u
   -------   a   ag        c          ug  acu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375307.1: 6214554-6214633 [-]
intergenic
Database links

Mature sequence cli-miR-9619-5p

Accession MIMAT0038727
Sequence

17 - 

uauuccuuaaguaggcaaaguu

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-9619-3p

Accession MIMAT0038728
Sequence

52 - 

uuuugccugcucaagggguaga

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).