Stem-loop sequence cli-mir-9620

AccessionMI0030097 (change log)
DescriptionColumba livia miR-9620 stem-loop
Stem-loop
   u    a                   a    c        ------     
5'  gcac auuuccccuuuaggagaaa aucu aguuauug      cacu 
    |||| ||||||||||||||||||| |||| ||||||||      ||| u
3'  cgug uaaaggggaaguccucuuu uaga ucaauaac      gugu 
   a    g                   a    a        uuaaau     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375542.1: 883590-883682 [-]
intergenic
Database links

Mature sequence cli-miR-9620-5p

Accession MIMAT0038729
Sequence

15 - 

uuuaggagaaaaaucucaguu

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-9620-3p

Accession MIMAT0038730
Sequence

60 - 

acuaagauauuucuccugaagg

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).