Stem-loop sequence cli-mir-9621

AccessionMI0030098 (change log)
DescriptionColumba livia miR-9621 stem-loop
Stem-loop
   acc      ca  aua       u       c      -uc  aa 
5'    ucccau  gg   caucccg ugggaug auucug   ag  u
      ||||||  ||   ||||||| ||||||| ||||||   ||  g
3'    ggggua  cc   guagggc acccuac uaggac   uc  c
   gac      cc  -ac       u       a      uac  ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375448.1: 6395723-6395813 [-]
intergenic
Database links

Mature sequence cli-miR-9621-5p

Accession MIMAT0038731
Sequence

19 - 

ucccguugggaugcauucuguc

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-9621-3p

Accession MIMAT0038732
Sequence

55 - 

caggauacaucccaucgggaug

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).