Stem-loop sequence cli-mir-1756b

AccessionMI0030099 (change log)
DescriptionColumba livia miR-1756b stem-loop
Stem-loop
   gga   c      c       au               ucuguca 
5'    ggg cagauc ucagcug  guaaauuaggagagc       a
      ||| |||||| |||||||  |||||||||||||||        
3'    ucc guuuag agucgac  cauuuaguccuuucg       u
   ggg   a      a       cu               caaauug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375875.1: 401725-401816 [+]
intergenic
Database links

Mature sequence cli-miR-1756b-5p

Accession MIMAT0038733
Sequence

17 - 

agcugauguaaauuaggagagc

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-1756b-3p

Accession MIMAT0038734
Sequence

57 - 

uuuccugauuuacuccagcuga

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).