Stem-loop sequence cli-mir-9622

AccessionMI0030101 (change log)
DescriptionColumba livia miR-9622 stem-loop
Stem-loop
   cgu    -a  a             -u     cc    a   gagg 
5'    gggg  ag ugccguggggguu  cccug  uggg ccc    u
      ||||  || |||||||||||||  |||||  |||| |||     
3'    ccuc  uc acgguacccccag  ggggc  gccc ggg    g
   cuu    gg  g             uc     -u    -   aagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375405.1: 5422806-5422895 [+]
intergenic
Database links

Mature sequence cli-miR-9622-5p

Accession MIMAT0038735
Sequence

17 - 

uggggguuucccugccugggac

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-9622-3p

Accession MIMAT0038736
Sequence

54 - 

cccgucggggcugacccccaug

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).