Stem-loop sequence cli-mir-9623

AccessionMI0030102 (change log)
DescriptionColumba livia miR-9623 stem-loop
Stem-loop
   uaccuag     u     ug            u    -   aac 
5'        gccuu ucuag  ugggauuuaaag ugug ugu   u
          ||||| |||||  |||||||||||| |||| |||    
3'        uggaa agguc  guccuaaauuuc auac aca   c
   -------     c     ug            c    g   gug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375384.1: 1928127-1928208 [-]
intergenic
Database links

Mature sequence cli-miR-9623-5p

Accession MIMAT0038737
Sequence

17 - 

agugugggauuuaaaguugugu

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-9623-3p

Accession MIMAT0038738
Sequence

54 - 

auaccuuuaaauccuggucugg

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).