Stem-loop sequence cli-mir-9625

AccessionMI0030104 (change log)
DescriptionColumba livia miR-9625 stem-loop
Stem-loop
   ga    au   a   g    a    a    cu     gaau 
5'   gagc  cgg gcu ucgg gccg uguu  agcug    g
     ||||  ||| ||| |||| |||| ||||  |||||     
3'   uucg  guc cga agcc cggu gcag  ucggc    a
   cc    gu   c   g    a    c    --     aaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB376210.1: 1982634-1982715 [-]
intergenic
Database links

Mature sequence cli-miR-9625-5p

Accession MIMAT0038741
Sequence

14 - 

cugucggagccgauguucuagcu

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-9625-3p

Accession MIMAT0038742
Sequence

51 - 

cugacgcuggcaccgagagcc

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).