Stem-loop sequence cli-mir-9626

AccessionMI0030105 (change log)
DescriptionColumba livia miR-9626 stem-loop
Stem-loop
   -----aa aa     ca    uu     aauaa      aaag   u 
5'        g  cagau  gggc  ggaga     cacgcu    agu u
          |  |||||  ||||  |||||     ||||||    |||  
3'        c  guuug  cccg  ucucu     gugugg    ucg c
   ugaccug cc     -a    uc     --cug      ----   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375315.1: 7537303-7537386 [+]
intergenic
Database links

Mature sequence cli-miR-9626-5p

Accession MIMAT0038743
Sequence

12 - 

agggcuuggagaaauaacacgcu

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-9626-3p

Accession MIMAT0038744
Sequence

51 - 

uguggucucucucugcccagu

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).