Stem-loop sequence cli-mir-9627

AccessionMI0030106 (change log)
DescriptionColumba livia miR-9627 stem-loop
Stem-loop
   gaa     ug   c  a           a g    -   ugg 
5'    gguuu  uag uc ggagcagugcc a gcug ggc   c
      |||||  ||| || ||||||||||| | |||| |||   u
3'    ccaaa  auc ag ccucgucacgg u cgac ccg   c
   guc     ua   c  a           g g    u   cgu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375513.1: 123086-123171 [+]
intergenic
Database links

Mature sequence cli-miR-9627-5p

Accession MIMAT0038745
Sequence

16 - 

caggagcagugccaaggcuggg

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-9627-3p

Accession MIMAT0038746
Sequence

52 - 

cagcgugggcacugcuccagac

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).