Stem-loop sequence cli-mir-9631

AccessionMI0030110 (change log)
DescriptionColumba livia miR-9631 stem-loop
Stem-loop
   guu            u     c    ug cu a        cu  gg 
5'    caaaggcacaga gauag cagg  c  c ucucaugc  gu  a
      |||||||||||| ||||| ||||  |  | ||||||||  ||   
3'    guuuccgugucu uuguc gucu  g  g agagugug  ca  a
   agc            u     a    gu ag -        uc  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375367.1: 2262179-2262273 [+]
intergenic
Database links

Mature sequence cli-miR-9631-5p

Accession MIMAT0038753
Sequence

19 - 

uagccaggugccucaucucaugcc

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-9631-3p

Accession MIMAT0038754
Sequence

57 - 

ugugagaggagugucugacuguu

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).