Stem-loop sequence cli-mir-9632

AccessionMI0030111 (change log)
DescriptionColumba livia miR-9632 stem-loop
Stem-loop
   cua    u   c         auuuu       ca   ucucuca 
5'    cuuc ggu aggccagaa     gcaagag  gcc       u
      |||| ||| |||||||||     |||||||  |||        
3'    gaag ccg ucuggucuu     cguuuuc  cgg       g
   ucc    u   u         -----       -a   uuuuaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375797.1: 144955-145040 [+]
intergenic
Database links

Mature sequence cli-miR-9632-5p

Accession MIMAT0038755
Sequence

12 - 

caggccagaaauuuugcaagagc

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-9632-3p

Accession MIMAT0038756
Sequence

57 - 

cacuuuugcuucuggucuugc

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).