Stem-loop sequence cli-mir-9633

AccessionMI0030112 (change log)
DescriptionColumba livia miR-9633 stem-loop
Stem-loop
   g g    a a     -    -   a    a        -uug u 
5'  g cucc c ugcag agga ugg gcug augggauu    c g
    | |||| | ||||| |||| ||| |||| ||||||||    | c
3'  c gagg g acguc uccu acc cgac uacccugg    g c
   a g    g c     g    g   c    c        uaaa u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375367.1: 761132-761219 [-]
intergenic
Database links

Mature sequence cli-miR-9633-5p

Accession MIMAT0038757
Sequence

14 - 

agaggauggagcugaauggga

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-9633-3p

Accession MIMAT0038758
Sequence

55 - 

ccauccagccccaguccugcugc

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).