Stem-loop sequence cli-mir-8993

AccessionMI0030113 (change log)
DescriptionColumba livia miR-8993 stem-loop
Stem-loop
   -ga  agg   -a              a         gg 
5'    gg   ggc  gggucaagggucaa ggucagggu  c
      ||   |||  |||||||||||||| |||||||||  c
3'    cc   ccg  cccaguuuccaguu ccaguucca  a
   gaa  -gg   ac              -         ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB376712.1: 5213-5289 [-]
intergenic
Database links

Mature sequence cli-miR-8993-5p

Accession MIMAT0038759
Sequence

10 - 

cagggucaagggucaaaggucag

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-8993-3p

Accession MIMAT0038760
Sequence

47 - 

ugaccuugaccuuugaccccagc

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).