Stem-loop sequence cli-mir-9634

AccessionMI0030114 (change log)
DescriptionColumba livia miR-9634 stem-loop
Stem-loop
   --- uc       c    u  c     ua    ag       gu 
5'    g  uaaaaau uugu cc uaugu  aggg  ccuguuu  a
      |  ||||||| |||| || |||||  ||||  |||||||  a
3'    c  auuuuug gaca gg auacg  uccc  ggacggg  a
   aca uu       u    -  a     --    cu       au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375368.1: 7984728-7984812 [-]
intergenic
Database links

Mature sequence cli-miR-9634-5p

Accession MIMAT0038761
Sequence

11 - 

cuuguucccuauguuaagggagcc

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-9634-3p

Accession MIMAT0038762
Sequence

54 - 

uccccugcauaaggacagugu

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).