Stem-loop sequence cli-mir-9635

AccessionMI0030115 (change log)
DescriptionColumba livia miR-9635 stem-loop
Stem-loop
   -cug      c              a           g   cuaau 
5'     agcaac ugaagcauauuuau cagauuaagug uuu     a
       |||||| |||||||||||||| ||||||||||| |||      
3'     ucguug acuucguguaagua gucuaauucac aga     c
   ugua      u              c           g   aaccu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375839.1: 451089-451181 [+]
intergenic
Database links

Mature sequence cli-miR-9635-5p

Accession MIMAT0038763
Sequence

18 - 

uauuuauacagauuaagugguuuc

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-9635-3p

Accession MIMAT0038764
Sequence

55 - 

agcacuuaaucugcaugaaugug

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).