Stem-loop sequence cli-mir-9638

AccessionMI0030118 (change log)
DescriptionColumba livia miR-9638 stem-loop
Stem-loop
   -aa           a     a            u    cucuccucu 
5'    auugagucauc gcagc aggaccacuuag ccug         c
      ||||||||||| ||||| |||||||||||| ||||          
3'    uaacucaguag cgucg uccuggugaauc ggac         u
   aca           c     c            u    accgcacuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375508.1: 134059-134153 [+]
intergenic
Database links

Mature sequence cli-miR-9638-5p

Accession MIMAT0038769
Sequence

17 - 

agcaaggaccacuuaguccugc

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-9638-3p

Accession MIMAT0038770
Sequence

59 - 

aggucuaagugguccucgcugc

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).