Stem-loop sequence cli-mir-9639

AccessionMI0030119 (change log)
DescriptionColumba livia miR-9639 stem-loop
Stem-loop
   ucu   - g       aa  a    gu    gu     cc    u 
5'    ccg g gcggugg  gg gccg  agcu  gcagc  gcug c
      ||| | |||||||  || ||||  ||||  |||||  |||| c
3'    ggc c ugccacc  cc cggc  ucga  cgucg  cgac g
   ucc   g g       ag  a    ac    gu     --    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375449.1: 2018342-2018431 [+]
intergenic
Database links

Mature sequence cli-miR-9639-5p

Accession MIMAT0038771
Sequence

17 - 

aggagccgguagcugugcagcc

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-9639-3p

Accession MIMAT0038772
Sequence

54 - 

cugcugagcucacggcaccgac

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).