Stem-loop sequence cli-mir-9640

AccessionMI0030120 (change log)
DescriptionColumba livia miR-9640 stem-loop
Stem-loop
   ca        ag      -  g   -ac       guucu g 
5'   cgggcggc  agccuc gc cug   ucugaag     g u
     ||||||||  |||||| || |||   |||||||     |  
3'   gcucgccg  ucggag cg gac   agacuuc     c a
   uc        cg      u  a   ggu       -agcu a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375952.1: 20863-20945 [+]
intergenic
Database links

Mature sequence cli-miR-9640-5p

Accession MIMAT0038773
Sequence

12 - 

gagccucgcgcugacucugaag

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-9640-3p

Accession MIMAT0038774
Sequence

51 - 

ucagauggcagagcugaggcugc

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).