Stem-loop sequence cli-mir-9641

AccessionMI0030121 (change log)
DescriptionColumba livia miR-9641 stem-loop
Stem-loop
   -guc     cu     a   c         gga  c      uuugu 
5'     ggcug  cggga ccg uggcacguu   gc cucgcc     g
       |||||  ||||| ||| |||||||||   || ||||||      
3'     ccggc  gcucu ggc accguguag   ug gagcgg     c
   cugu     -u     c   -         ---  c      cucuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375748.1: 504479-504568 [+]
intergenic
Database links

Mature sequence cli-miR-9641-5p

Accession MIMAT0038775
Sequence

17 - 

ccgcuggcacguuggagcccucgcc

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-9641-3p

Accession MIMAT0038776
Sequence

56 - 

cgagcgugaugugccacggcuc

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).