Stem-loop sequence cli-mir-9645

AccessionMI0030125 (change log)
DescriptionColumba livia miR-9645 stem-loop
Stem-loop
   ccu  g       --         a   g   g u  agga 
5'    gu cagcacu  ugccaccac gug gcu c gc    c
      || |||||||  ||||||||| ||| ||| | ||     
3'    ua gucguga  augguggug cac cga g cg    a
   guc  g       cc         g   a   g c  auac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375299.1: 2361600-2361681 [-]
intergenic
Database links

Mature sequence cli-miR-9645-5p

Accession MIMAT0038783
Sequence

14 - 

ugccaccacagugggcugcugc

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-9645-3p

Accession MIMAT0038784
Sequence

48 - 

cggagcacacgguggugguacc

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).