Stem-loop sequence cli-mir-9646

AccessionMI0030126 (change log)
DescriptionColumba livia miR-9646 stem-loop
Stem-loop
   uua                 a                    aa 
5'    gagugguauuuagaccg uuguugguaguguucuuuau  a
      ||||||||||||||||| ||||||||||||||||||||  a
3'    uucaccguaaaucuggc agcaaccaucacaagaaaua  a
   cua                 c                    gc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375350.1: 3459158-3459246 [-]
intergenic
Database links

Mature sequence cli-miR-9646-5p

Accession MIMAT0038785
Sequence

19 - 

cgauuguugguaguguucuuua

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-9646-3p

Accession MIMAT0038786
Sequence

52 - 

aagaacacuaccaacgaccggu

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).