Stem-loop sequence cli-mir-9649

AccessionMI0030129 (change log)
DescriptionColumba livia miR-9649 stem-loop
Stem-loop
   gaa    aa    u       gg  u    -        gug  auu 
5'    ggua  gaag uacacug  uc ccca caucucug   ag   u
      ||||  |||| |||||||  || |||| ||||||||   ||    
3'    cuau  cuuc augugac  ag gggu guagagac   uc   u
   uga    -a    u       aa  u    c        --a  gau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB376086.1: 255207-255298 [-]
intergenic
Database links

Mature sequence cli-miR-9649-5p

Accession MIMAT0038791
Sequence

17 - 

cacugggucucccacaucucug

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-9649-3p

Accession MIMAT0038792
Sequence

57 - 

gagaugcugggugaaacagugu

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).