Stem-loop sequence mmu-mir-3154

AccessionMI0030343 (change log)
DescriptionMus musculus miR-3154 stem-loop
Gene family MIPF0001387; mir-3154
Stem-loop
   ggc     cu   caaccca       -   a   --     -a gu 
5'    cccuc  ucc       gcucccg cuc ccc  cugcc  c  c
      |||||  |||       ||||||| ||| |||  |||||  |   
3'    gggag  agg       cgagggc gag ggg  gacgg  g  a
   ---     --   -------       u   -   aa     ag aa 
Get sequence
Deep sequencing
62 reads, 9.68 reads per million, 31 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 32318265-32318343 [+]
sense
ENSMUST00000175024 ; Gm23363-201; exon 1
antisense
OTTMUST00000031111 ; Dnm1-013; intron 1
OTTMUST00000031103 ; Dnm1-005; intron 14
OTTMUST00000031101 ; Dnm1-003; intron 15
OTTMUST00000031100 ; Dnm1-002; intron 15
OTTMUST00000031102 ; Dnm1-004; intron 15
OTTMUST00000031099 ; Dnm1-006; intron 15
OTTMUST00000031104 ; Dnm1-001; intron 15
ENSMUST00000129156 ; Dnm1-013; intron 1
ENSMUST00000091089 ; Dnm1-005; intron 14
ENSMUST00000078352 ; Dnm1-003; intron 15
ENSMUST00000113352 ; Dnm1-002; intron 15
ENSMUST00000113350 ; Dnm1-004; intron 15
ENSMUST00000139624 ; Dnm1-006; intron 15
ENSMUST00000113365 ; Dnm1-001; intron 15
Clustered miRNAs
< 10kb from mmu-mir-3154
mmu-mir-3154chr2: 32318265-32318343 [+]
mmu-mir-199bchr2: 32318460-32318569 [+]
Database links

Mature sequence mmu-miR-3154

Accession MIMAT0035714
Sequence

53 - 

cagaaggggagucgggagcgga

 - 74

Get sequence
Deep sequencing51 reads, 24 experiments
Evidence experimental; RNAseq-metaanalysis [1]
Database links
Predicted targets

References

1
PMID:23329697 "Rat mir-155 generated from the lncRNA Bic is 'hidden' in the alternate genomic assembly and reveals the existence of novel mammalian miRNAs and clusters" Uva P, Da Sacco L, Del Corno M, Baldassarre A, Sestili P, Orsini M, Palma A, Gessani S, Masotti A RNA. 19:365-379(2013).