Stem-loop sequence rno-let-7g

AccessionMI0030347 (change log)
DescriptionRattus norvegicus let-7g stem-loop
Gene family MIPF0000002; let-7
Literature search

92 open access papers mention rno-let-7g
(462 sentences)

Stem-loop
     a   u        a            ugagg    -a  a    a 
5' cc ggc gagguagu guuuguacaguu     gucu  ug uacc c
   || ||| |||||||| ||||||||||||     ||||  || ||||  
3' gg ccg uuccguca cggacaugucaa     uaga  ac augg c
     a   -        c            -----    gg  -    c 
Get sequence
Deep sequencing
19810864 reads, 1.85e+04 reads per million, 514 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr8: 114874457-114874544 [+]
sense
Database links

Mature sequence rno-let-7g-5p

Accession MIMAT0035719
Sequence

7 - 

ugagguaguaguuuguacaguu

 - 28

Get sequence
Deep sequencing19800864 reads, 513 experiments
Evidence experimental; RNAseq-metaanalysis [1]
Predicted targets

Mature sequence rno-let-7g-3p

Accession MIMAT0035720
Sequence

64 - 

cuguacaggccacugccuugc

 - 84

Get sequence
Deep sequencing9915 reads, 447 experiments
Evidence experimental; RNAseq-metaanalysis [1]
Predicted targets

References

1
PMID:23329697 "Rat mir-155 generated from the lncRNA Bic is 'hidden' in the alternate genomic assembly and reveals the existence of novel mammalian miRNAs and clusters" Uva P, Da Sacco L, Del Corno M, Baldassarre A, Sestili P, Orsini M, Palma A, Gessani S, Masotti A RNA. 19:365-379(2013).