Stem-loop sequence rno-mir-1247

AccessionMI0030348 (change log)
DescriptionRattus norvegicus miR-1247 stem-loop
Gene family MIPF0000669; mir-1247
Stem-loop
   cggccgc       a  c   c  uu   c     acguu  u 
5'        cgggcgc cc guc cg  cgu cccgg     gc c
          ||||||| || ||| ||  ||| |||||     || u
3'        gcccgcg gg cag gc  gca gggcc     cg c
   --gucaa       a  u   a  -u   a     ----c  u 
Get sequence
Deep sequencing
21046 reads, 3.69 reads per million, 434 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 134626097-134626178 [-]
intergenic
Database links

Mature sequence rno-miR-1247-5p

Accession MIMAT0035721
Sequence

15 - 

acccgucccguucguccccgga

 - 36

Get sequence
Deep sequencing19867 reads, 425 experiments
Evidence experimental; RNAseq-metaanalysis [1]
Predicted targets

Mature sequence rno-miR-1247-3p

Accession MIMAT0035722
Sequence

52 - 

cgggaacgucgagacuggagc

 - 72

Get sequence
Deep sequencing1155 reads, 252 experiments
Evidence experimental; RNAseq-metaanalysis [1]
Predicted targets

References

1
PMID:23329697 "Rat mir-155 generated from the lncRNA Bic is 'hidden' in the alternate genomic assembly and reveals the existence of novel mammalian miRNAs and clusters" Uva P, Da Sacco L, Del Corno M, Baldassarre A, Sestili P, Orsini M, Palma A, Gessani S, Masotti A RNA. 19:365-379(2013).