Stem-loop sequence rno-mir-1956

AccessionMI0030356 (change log)
DescriptionRattus norvegicus miR-1956 stem-loop
Stem-loop
   ---uca       -   g      c      cg 
5'       guccagg gcu agucag ggagcc  g
         ||||||| ||| |||||| ||||||   
3'       caggucc cgg ucgguc cuucgg  a
   cggaug       a   -      c      ug 
Get sequence
Deep sequencing
892 reads, 0 reads per million, 275 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr2: 243819838-243819900 [+]
sense
Database links

Mature sequence rno-miR-1956-5p

Accession MIMAT0035735
Sequence

3 - 

aguccagggcugagucagcgga

 - 24

Get sequence
Deep sequencing578 reads, 232 experiments
Evidence experimental; RNAseq-metaanalysis [1]
Predicted targets

Mature sequence rno-miR-1956-3p

Accession MIMAT0035736
Sequence

42 - 

uggcuggcaccuggacgu

 - 59

Get sequence
Deep sequencing309 reads, 158 experiments
Evidence experimental; RNAseq-metaanalysis [1]
Predicted targets

References

1
PMID:23329697 "Rat mir-155 generated from the lncRNA Bic is 'hidden' in the alternate genomic assembly and reveals the existence of novel mammalian miRNAs and clusters" Uva P, Da Sacco L, Del Corno M, Baldassarre A, Sestili P, Orsini M, Palma A, Gessani S, Masotti A RNA. 19:365-379(2013).