Stem-loop sequence rno-mir-452

AccessionMI0030363 (change log)
DescriptionRattus norvegicus miR-452 stem-loop
Gene family MIPF0000287; mir-452
Stem-loop
     u  a       aac g        g  a        uuca 
5' gc aa cacuuac   u uuugcaga ga acugagac    u
   || || |||||||   | |||||||| || ||||||||    a
3' cg uu gugaaug   a aaacgucu cu ugacucug    g
     u  c       --a g        a  c        uauc 
Get sequence
Deep sequencing
1435 reads, 0 reads per million, 284 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rno-miR-452-5p

Accession MIMAT0035748
Sequence

14 - 

aacuguuugcagaggaaacugag

 - 36

Get sequence
Deep sequencing1214 reads, 265 experiments
Evidence experimental; RNAseq-metaanalysis [1]
Predicted targets

Mature sequence rno-miR-452-3p

Accession MIMAT0035749
Sequence

53 - 

ucagucucaucugcaaagaag

 - 73

Get sequence
Deep sequencing219 reads, 115 experiments
Evidence experimental; RNAseq-metaanalysis [1]
Predicted targets

References

1
PMID:23329697 "Rat mir-155 generated from the lncRNA Bic is 'hidden' in the alternate genomic assembly and reveals the existence of novel mammalian miRNAs and clusters" Uva P, Da Sacco L, Del Corno M, Baldassarre A, Sestili P, Orsini M, Palma A, Gessani S, Masotti A RNA. 19:365-379(2013).