Stem-loop sequence rno-mir-5132

AccessionMI0030364 (change log)
DescriptionRattus norvegicus miR-5132 stem-loop
Gene family MIPF0002061; mir-5132
Stem-loop
   c      ac         u    -c        ug 
5'  aggccg  guggggcgg ggac  caggcuuc  g
    ||||||  ||||||||| ||||  ||||||||  a
3'  uccggc  cgcccugcc cuug  guccgaag  g
   -      ga         c    ua        uc 
Get sequence
Deep sequencing
434 reads, 0 reads per million, 202 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chrX: 156716797-156716867 [+]
sense
ENSRNOT00000065177 ; Irak1-201; 3'UTR (exon 2)
Database links

Mature sequence rno-miR-5132-5p

Accession MIMAT0035750
Sequence

9 - 

cguggggcgguggacccaggcu

 - 30

Get sequence
Deep sequencing203 reads, 125 experiments
Evidence experimental; RNAseq-metaanalysis [1]
Predicted targets

Mature sequence rno-miR-5132-3p

Accession MIMAT0035751
Sequence

44 - 

ccugauguuccccgucccgcagc

 - 66

Get sequence
Deep sequencing225 reads, 131 experiments
Evidence experimental; RNAseq-metaanalysis [1]
Predicted targets

References

1
PMID:23329697 "Rat mir-155 generated from the lncRNA Bic is 'hidden' in the alternate genomic assembly and reveals the existence of novel mammalian miRNAs and clusters" Uva P, Da Sacco L, Del Corno M, Baldassarre A, Sestili P, Orsini M, Palma A, Gessani S, Masotti A RNA. 19:365-379(2013).