Stem-loop sequence tae-MIR1127b

AccessionMI0030379 (change log)
DescriptionTriticum aestivum miR1127b stem-loop
Gene family MIPF0000382; MIR1122
Literature search

7 open access papers mention tae-MIR1127b
(20 sentences)

Stem-loop
   c    caga g                      c  ---------     c     a    gacuua 
5'  auga    u cuucuguccggaaauacuuguc ua         gaaau ggugu ucua      u
    ||||    | |||||||||||||||||||||| ||         ||||| ||||| ||||      u
3'  uauu    a ggaggcaggucuuuaugaacag au         uuuua cuaca agau      u
   a    -aug g                      a  auuuaccua     c     c    auuaau 
Get sequence
Deep sequencing
195059 reads, 572 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
2A: 6474469-6474595 [+]
intergenic
Database links

Mature sequence tae-miR1127b-3p

Accession MIMAT0035769
Sequence

97 - 

acaaguauuucuggacggagg

 - 117

Get sequence
Deep sequencing183489 reads, 116 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).