Stem-loop sequence tae-MIR396

AccessionMI0030381 (change log)
DescriptionTriticum aestivum miR396 stem-loop
Literature search

21 open access papers mention tae-MIR396
(60 sentences)

Stem-loop
   -                g   uc          ggauu  cu   uugu    c 
5'  ggcuuucuugaacugu aac  gcggggaugg     cc  gga    ggcg u
    |||||||||||||||| |||  ||||||||||     ||  |||    ||||  
3'  ccgaaagaacuuggua uug  cgccucugcc     gg  ucu    ccgu c
   c                g   uc          -----  cu   -cuu    c 
Get sequence
Deep sequencing
21124 reads, 19 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tae-miR396-5p

Accession MIMAT0035771
Sequence

11 - 

aacugugaacucgcggggaug

 - 31

Get sequence
Deep sequencing17754 reads, 116 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).