Stem-loop sequence tae-MIR167c

AccessionMI0030399 (change log)
DescriptionTriticum aestivum miR167c stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

28 open access papers mention tae-MIR167c
(122 sentences)

Stem-loop
   c  -   c    -        c         c           cucauccagcaugcgccgaaaccgcguucgg 
5'  cu uug uggu gugagaga ugaagcugc agcaugaucug                               u
    || ||| |||| |||||||| ||||||||| |||||||||||                                
3'  ga aac accg cacucuuu acuucgacg ucguacuagac                               u
   a  c   c    g        u         -           uaccucguuuuuaagguucuauuggggcgcg 
Get sequence
Deep sequencing
1392853 reads, 6.51e+03 reads per million, 116 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
6D: 53810988-53811134 [+]
intergenic
Database links

Mature sequence tae-miR167c-5p

Accession MIMAT0035789
Sequence

21 - 

ugaagcugccagcaugaucugc

 - 42

Get sequence
Deep sequencing1299649 reads, 116 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).