Stem-loop sequence tae-MIR1120b

AccessionMI0030404 (change log)
DescriptionTriticum aestivum miR1120b stem-loop
Gene family MIPF0000443; MIR1120
Literature search

13 open access papers mention tae-MIR1120b
(46 sentences)

Stem-loop
   uaaa                a                     cua 
5'     uacucccucuguccca aauauaagaacauuuuugaca   u
       |||||||||||||||| |||||||||||||||||||||   u
3'     augagggagacagggu uuauauucuuguaaaaauugu   g
   uuug                g                     aau 
Get sequence
Deep sequencing
257234 reads, 596 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
7B: 15312620-15312712 [+]
intergenic
Database links

Mature sequence tae-miR1120b-3p

Accession MIMAT0035794
Sequence

63 - 

uucuuauauugugggacagag

 - 83

Get sequence
Deep sequencing233528 reads, 116 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).