Stem-loop sequence tae-MIR1120c

AccessionMI0030409 (change log)
DescriptionTriticum aestivum miR1120c stem-loop
Gene family MIPF0000443; MIR1120
Literature search

13 open access papers mention tae-MIR1120c
(45 sentences)

Stem-loop
   -          u                          
5'  cucuguccca aauauaagaacguuuuugacacuag 
    |||||||||| |||||||||||||||||||||||| u
3'  gagacagggu uuauauucuugcaaaaauugugaug 
   g          u                          
Get sequence
Deep sequencing
206576 reads, 564 reads per million, 116 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
3D: 73734313-73734386 [+]
intergenic
Database links

Mature sequence tae-miR1120c-5p

Accession MIMAT0035799
Sequence

11 - 

uaauauaagaacguuuuugac

 - 31

Get sequence
Deep sequencing44967 reads, 116 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).