Stem-loop sequence hvu-MIR397b

AccessionMI0030545 (change log)
DescriptionHordeum vulgare miR397b stem-loop
Gene family MIPF0000120; MIR397
Literature search

4 open access papers mention hvu-MIR397b
(20 sentences)

Stem-loop
          c   a   c        cc         c       uc   gga g 
5' gcagagg guc uug gugcagcg  ggugaaccg uccggcc  ggu   g c
   ||||||| ||| ||| ||||||||  ||||||||| |||||||  |||   | g
3' cgucucc cgg aac cacgucgc  cuacuuggc aggccgg  ccg   c g
          a   c   u        aa         -       ua   -gg a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hvu-miR397b-3p

Accession MIMAT0035814
Sequence

79 - 

aucaacgcugcacucaacggc

 - 99

Get sequence
Evidence experimental; Northern [1]

References

1
PMID:23324356 "Developmentally regulated expression and complex processing of barley pri-microRNAs" Kruszka K, Pacak A, Swida-Barteczka A, Stefaniak AK, Kaja E, Sierocka I, Karlowski W, Jarmolowski A, Szweykowska-Kulinska Z BMC Genomics. 14:34(2013).