Stem-loop sequence hvu-MIR156b

AccessionMI0030546 (change log)
DescriptionHordeum vulgare miR156b stem-loop
Gene family MIPF0000008; MIR156
Literature search

18 open access papers mention hvu-MIR156b
(164 sentences)

Stem-loop
            -    a        a         g         --auaaagagga  gau 
5' gcugacaga agag gugagcac cagcggcag cugcgucug            cg   g
   ||||||||| |||| |||||||| ||||||||| |||||||||            ||    
3' cgacugucu ucuc cacucgug guugucguc gacgcagau            gc   g
            c    c        c         -         agagagagagaa  gua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hvu-miR156b

Accession MIMAT0035815
Sequence

3 - 

ugacagaagagagugagcaca

 - 23

Get sequence
Evidence experimental; Northern [1]

References

1
PMID:23324356 "Developmentally regulated expression and complex processing of barley pri-microRNAs" Kruszka K, Pacak A, Swida-Barteczka A, Stefaniak AK, Kaja E, Sierocka I, Karlowski W, Jarmolowski A, Szweykowska-Kulinska Z BMC Genomics. 14:34(2013).