Stem-loop sequence chi-let-7a

AccessionMI0030579 (change log)
DescriptionCapra hircus let-7a stem-loop
Gene family MIPF0000002; let-7
Literature search

17 open access papers mention chi-let-7a
(47 sentences)

Stem-loop
   agacug      -   ug   u   gu                ---------        
5'       acggcc cuu  ggg gag  aguagguuguauaguu         uggggcu 
         |||||| |||  ||| |||  ||||||||||||||||         |||||| c
3'       ugucgg gaa  ccu uuc  ucaucuaacauaucaa         gucccgu 
   --auaa      u   gu   -   ug                uaggguauc        
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr5: 118521992-118522097 [+]
intergenic
Clustered miRNAs
< 10kb from chi-let-7a
chi-let-7achr5: 118521992-118522097 [+]
chi-let-7bchr5: 118522775-118522871 [+]
Database links

Mature sequence chi-let-7a-5p

Accession MIMAT0035880
Sequence

21 - 

ugagguaguagguuguauaguu

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-let-7a-3p

Accession MIMAT0035881
Sequence

69 - 

cuauacaaucuacugucuuucc

 - 90

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).