Stem-loop sequence chi-let-7g

AccessionMI0030585 (change log)
DescriptionCapra hircus let-7g stem-loop
Gene family MIPF0000002; let-7
Literature search

16 open access papers mention chi-let-7g
(39 sentences)

Stem-loop
   ccuuuugc   a    a   u        a            ugagg    -a  a    a 
5'         cug uucc ggc gagguagu guuuguacaguu     gucu  ug uacc c
           ||| |||| ||| |||||||| ||||||||||||     ||||  || ||||  
3'         gac aagg ccg uuccguca cggacaugucaa     uaga  ac augg c
   --------   -    g   -        c            -----    gg  -    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr22: 50154243-50154349 [+]
intergenic
Database links

Mature sequence chi-let-7g-5p

Accession MIMAT0035892
Sequence

21 - 

ugagguaguaguuuguacaguu

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-let-7g-3p

Accession MIMAT0035893
Sequence

78 - 

cuguacaggccacugccuugcc

 - 99

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).