Stem-loop sequence chi-mir-1248

AccessionMI0030602 (change log)
DescriptionCapra hircus miR-1248 stem-loop
Gene family MIPF0000622; mir-1248
Literature search

1 open access papers mention chi-mir-1248
(1 sentences)

Stem-loop
   --------uuuac        a   gc   g     ---aa               a 
5'              cuucuugu uaa  acu ugcua     auuacagaaaccaag u
                |||||||| |||  ||| |||||     ||||||||||||||| a
3'              gaagaaca auu  uga acgau     uaguguuuuugguuu a
   acgucaaggagaa        a   -a   g     cguaa               c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr1: 82475089-82475193 [-]
intergenic
chr1: 121736341-121736445 [-]
intergenic
Database links

Mature sequence chi-miR-1248-5p

Accession MIMAT0035920
Sequence

4 - 

accuucuuguauaagcacug

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).