Stem-loop sequence chi-mir-128

AccessionMI0030610 (change log)
DescriptionCapra hircus miR-128 stem-loop
Gene family MIPF0000048; mir-128
Literature search

3 open access papers mention chi-mir-128
(4 sentences)

   uguuuaauauuuugcaauaauu    uu uuccu    u      uuc       uag      cu       u 
5'                       ggcc  g     gagc guugga   ggggccg   cacugu  gagaggu u
                         ||||  |     |||| ||||||   |||||||   ||||||  |||||||  
3'                       ucgg  c     uucg cgacuu   cucuggc   gugaca  cucuuua a
   -----------cucauuuuucu    uc -----    u      uuu       caa      --       c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr2: 65017076-65017207 [-]
Database links

Mature sequence chi-miR-128-5p

Accession MIMAT0035933

48 - 


 - 70

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-128-3p

Accession MIMAT0035934

83 - 


 - 103

Get sequence
Evidence experimental; Illumina [1]


PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).