Stem-loop sequence chi-mir-128

AccessionMI0030610
DescriptionCapra hircus miR-128 stem-loop
Gene family MIPF0000048; mir-128
Stem-loop
   uguuuaauauuuugcaauaauu    uu uuccu    u      uuc       uag      cu       u 
5'                       ggcc  g     gagc guugga   ggggccg   cacugu  gagaggu u
                         ||||  |     |||| ||||||   |||||||   ||||||  |||||||  
3'                       ucgg  c     uucg cgacuu   cucuggc   gugaca  cucuuua a
   -----------cucauuuuucu    uc -----    u      uuu       caa      --       c 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_1.0) Overlapping transcripts
chr2: 60998558-60998689 [-]
intergenic

Mature sequence chi-miR-128-5p

Accession MIMAT0035933
Sequence

48 - 

cggggccguagcacugucugaga

 - 70

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-128-3p

Accession MIMAT0035934
Sequence

83 - 

ucacagugaaccggucucuuu

 - 103

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).