Stem-loop sequence chi-mir-129

AccessionMI0030612 (change log)
DescriptionCapra hircus miR-129 stem-loop
Gene family MIPF0000073; mir-129
Literature search

1 open access papers mention chi-mir-129
(2 sentences)

Stem-loop
   aagccggcagacucu             -       c   cu      ---     acau 
5'                gcccuucgcgaau cuuuuug ggu  gggcuu   gcugu    a
                  ||||||||||||| ||||||| |||  ||||||   |||||     
3'                cgggaggcgcuua gaaaaac cca  cccgaa   cgaua    a
   ----------ucacg             c       c   uu      ggc     acuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr15: 76204085-76204192 [+]
intergenic
Database links

Mature sequence chi-miR-129-5p

Accession MIMAT0035936
Sequence

29 - 

cuuuuugcggucugggcuugc

 - 49

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-129-3p

Accession MIMAT0035937
Sequence

71 - 

aagcccuuaccccaaaaagcau

 - 92

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).