Stem-loop sequence chi-mir-135b

AccessionMI0030623 (change log)
DescriptionCapra hircus miR-135b stem-loop
Gene family MIPF0000028; mir-135
Literature search

1 open access papers mention chi-mir-135b
(1 sentences)

Stem-loop
   -------------------g   u                   cau          uuacug 
5'                     cuc gcuguggccuauggcuuuu   uccuauguga      u
                       ||| |||||||||||||||||||   ||||||||||       
3'                     gag ugacauuggguaccgaaaa   gggauguacu      u
   cguccucauccgcgcgcggg   -                   -uc          caaacc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr16: 2864806-2864910 [-]
intergenic
Database links

Mature sequence chi-miR-135b-5p

Accession MIMAT0035953
Sequence

15 - 

uauggcuuuucauuccuauguga

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-135b-3p

Accession MIMAT0035954
Sequence

54 - 

auguagggcuaaaagccaugg

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).