Stem-loop sequence chi-mir-137

AccessionMI0030625 (change log)
DescriptionCapra hircus miR-137 stem-loop
Gene family MIPF0000106; mir-137
Literature search

1 open access papers mention chi-mir-137
(1 sentences)

Stem-loop
   ---g u  u   --           ug   g           ug a     -  g 
5'     g cc cug  acucucuucgg  acg guauucuuggg  g uaaua cg a
       | || |||  |||||||||||  ||| |||||||||||  | ||||| || u
3'     c gg gac  ugagaggagcu  ugc cauaagaauuc  u auugu gc u
   cgga -  c   ca           ga   g           gu -     u  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr3: 47943784-47943888 [+]
intergenic
Database links

Mature sequence chi-miR-137

Accession MIMAT0035957
Sequence

61 - 

auugcuuaagaauacgcguagu

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).