Stem-loop sequence chi-mir-150

AccessionMI0030638 (change log)
DescriptionCapra hircus miR-150 stem-loop
Gene family MIPF0000197; mir-150
Literature search

2 open access papers mention chi-mir-150
(4 sentences)

Stem-loop
   ------ucuc      u  -           aacc          u ug gu 
5'           uucuca gg cccugucuccc    cuuguaccag g  u  c
             |||||| || |||||||||||    |||||||||| |  |   
3'           aggggu cc gggacggaggg    ggacaugguc c  g  u
   cgacgacccu      -  a           gcau          - cu gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr18: 60483886-60483982 [-]
intergenic
Database links

Mature sequence chi-miR-150

Accession MIMAT0035980
Sequence

19 - 

ucucccaacccuuguaccagug

 - 40

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).