Stem-loop sequence chi-mir-18b

AccessionMI0030661 (change log)
DescriptionCapra hircus miR-18b stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   auaaugu  cu         --   u    c   u     ua  --g     
5'        gu  cuuguguua  agg gcau uag gcagu  gu   aagc 
          ||  |||||||||  ||| |||| ||| |||||  ||   ||| a
3'        cg  ggacacggu  ucc cgua auc cguca  ua   uucg 
   -----uc  uc         cu   u    a   c     uc  aua     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chrX: 40075324-40075417 [-]
intergenic
Clustered miRNAs
< 10kb from chi-mir-18b
chi-mir-106achrX: 40075491-40075571 [-]
chi-mir-18bchrX: 40075324-40075417 [-]
chi-mir-20bchrX: 40075091-40075165 [-]
chi-mir-92bchrX: 40074814-40074900 [-]
chi-mir-363chrX: 40074650-40074760 [-]
Database links

Mature sequence chi-miR-18b-5p

Accession MIMAT0036017
Sequence

19 - 

uaaggugcaucuagugcag

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-18b-3p

Accession MIMAT0036018
Sequence

59 - 

uacugcccuaaaugcuccuucu

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).