Stem-loop sequence chi-mir-20b

AccessionMI0030687 (change log)
DescriptionCapra hircus miR-20b stem-loop
Gene family MIPF0000001; mir-17
Literature search

1 open access papers mention chi-mir-20b
(1 sentences)

Stem-loop
   ------     -ca           g     g   uuu  g 
5'       aguac   aagugcucaca ugcag uag   ug c
         |||||   ||||||||||| ||||| |||   ||  
3'       ucaug   uucacgggugu auguc auc   ac a
   agguuc     acc           g     -   -uu  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chrX: 40075091-40075165 [-]
intergenic
Clustered miRNAs
< 10kb from chi-mir-20b
chi-mir-106achrX: 40075491-40075571 [-]
chi-mir-18bchrX: 40075324-40075417 [-]
chi-mir-20bchrX: 40075091-40075165 [-]
chi-mir-92bchrX: 40074814-40074900 [-]
chi-mir-363chrX: 40074650-40074760 [-]
Database links

Mature sequence chi-miR-20b

Accession MIMAT0036056
Sequence

6 - 

caaagugcucacagugcagguag

 - 28

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).