Stem-loop sequence chi-mir-214

AccessionMI0030689 (change log)
DescriptionCapra hircus miR-214 stem-loop
Gene family MIPF0000062; mir-214
Literature search

4 open access papers mention chi-mir-214
(10 sentences)

Stem-loop
   ggccu      acgga           u          aca            aacau 
5'      ggcugg     guugucaugug cugccugucu   cuugcugugcag     c
        ||||||     ||||||||||| ||||||||||   ||||||||||||     c
3'      ccgacc     caacaguacac gacggacaga   ggacgacauguc     g
   --agu      -----           u          cac            cacuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr16: 39501613-39501724 [-]
intergenic
Clustered miRNAs
< 10kb from chi-mir-214
chi-mir-199achr16: 39507404-39507513 [-]
chi-mir-214chr16: 39501613-39501724 [-]
Database links

Mature sequence chi-miR-214-5p

Accession MIMAT0036058
Sequence

30 - 

ugccugucuacacuugcugugc

 - 51

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-214-3p

Accession MIMAT0036059
Sequence

70 - 

uacagcaggcacagacaggc

 - 89

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).