Stem-loop sequence chi-mir-217

AccessionMI0030693 (change log)
DescriptionCapra hircus miR-217 stem-loop
Gene family MIPF0000077; mir-217
Literature search

1 open access papers mention chi-mir-217
(1 sentences)

Stem-loop
   -----aauauaauuaacag    u    uguc    auac     c          u -   aag 
5'                    agau uuga    gcag    ugcau aggaacugau g gau   a
                      |||| ||||    ||||    ||||| |||||||||| | |||    
3'                    ucua gacu    cguu    acgua uccuugacua c cug   a
   auaaaugacuacgaacaaa    c    --uc    ----     c          c a   gcu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr11: 39587116-39587235 [-]
intergenic
Database links

Mature sequence chi-miR-217-5p

Accession MIMAT0036064
Sequence

33 - 

uacugcaucaggaacugauugga

 - 55

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-217-3p

Accession MIMAT0036065
Sequence

70 - 

caucaguuccucaugcauugc

 - 90

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).