Stem-loop sequence chi-mir-221

AccessionMI0030696 (change log)
DescriptionCapra hircus miR-221 stem-loop
Gene family MIPF0000051; mir-221
Literature search

3 open access papers mention chi-mir-221
(3 sentences)

Stem-loop
   -----ccaaca       cuag   a    -  ug   u         auuu    -      
5'            uccaggu    ggc ugaa cc  gca acaauguag    cugu guuug 
              |||||||    ||| |||| ||  ||| |||||||||    |||| |||| u
3'            aggucca    ucg acuu gg  cgu uguuacauc    gaca cgagu 
   uucuugcacaa       ----   g    u  gu   c         ----    a      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chrX: 93117822-93117931 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-221
chi-mir-222chrX: 93117133-93117244 [+]
chi-mir-221chrX: 93117822-93117931 [+]
Database links

Mature sequence chi-miR-221-5p

Accession MIMAT0036068
Sequence

25 - 

accuggcauacaauguagauu

 - 45

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-221-3p

Accession MIMAT0036069
Sequence

65 - 

agcuacauugucugcuggguuu

 - 86

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).