Stem-loop sequence chi-mir-2411

AccessionMI0030715 (change log)
DescriptionCapra hircus miR-2411 stem-loop
Literature search

2 open access papers mention chi-mir-2411
(2 sentences)

Stem-loop
   agaggaa      -     cu u   aug       - agaa 
5'        augugg aguga  g cag   cagccag c    u
          |||||| |||||  | |||   ||||||| |     
3'        uacacc ucauu  c guc   gucgguu g    a
   ------c      c     -- u   -aa       u guga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr3: 16979525-16979599 [-]
intergenic
Database links

Mature sequence chi-miR-2411-5p

Accession MIMAT0036093
Sequence

10 - 

guggagugacugucagaugcagccagc

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-2411-3p

Accession MIMAT0036094
Sequence

53 - 

cugaacugucuuacucccacauc

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).